There are 424 articles for you to read.

Assembly and Variant Calling in Acinetobacter baumannii Genomes

Author: gene_x

Abstract: 1. input data #Deciphering Evolutionary Trajectories in Acinetobacter baumannii: A Comparative Study of Isolates ATCC 19606, AYE, and ATCC 17978 #PRJNA1041744

Small RNA sequencing processing in the example of smallRNA_7

Author: gene_x

Abstract: 1. adapter sequence Lexogen small RNA-Seq kit some common adapter sequences from different kits for reference: - TruSeq Small RNA (Illumina): TGGAATTCTCGGGTGCCAAGG - Small RNA Kits V1 (Il

Regulating Gene Expression in Diploid Organisms with Different Haplotypes

Author: gene_x

Abstract: If two haplotypes in a diploid organism are different, then the genome sequences for those haplotypes are also different. These genetic differences can indeed impact gene expression, and there are var

Peak and Motif analyses in Promoters

Author: gene_x

Abstract: * ./1_generate_promoter_sequences.py gencode.v43.annotation.gtf.db [1_generate_promoter_sequences.py](/static/peaks_and_motifs_in_promoters/1_generate_promoter_sequences.py "1_generate_promoter_sequ

Density of motif plots and its statistical tests

Author: gene_x

Abstract: [![Density_of_GRGGC_Motifs](/static/peaks_and_motifs_in_promoters/Density_of_GRGGC_Motifs.png "Density_of_GRGGC_Motifs")](/static/peaks_and_motifs_in_promoters/Density_of_GRGGC_Motifs.png "Density_of_

Small RNA processing

Author: gene_x

Abstract: Small RNA sequencing is a type of RNA-sequencing (RNA-seq) that specifically targets and sequences small RNA molecules in a sample. RNA-seq is a technique that uses next-generation sequencing (NGS) t

ChIP-seq using HOMER (-style factor, findPeaks + default getDifferentialPeaksReplicates.pl)

Author: gene_x

Abstract: 1. nextflow ChIP-seq run for NHDF_p783 #under Raw_Data for ChIP-seq ln -s ./230306_NB501882_0417_AHMVHHBGXN/2023_022_nf_denise/nf859/3_NHDF_Donor_1_p783_input_S5_R1_001.fastq.gz p783

Prepare the databases for vrap

Author: gene_x

Abstract: 1. I used an strategy, at first annotate the contigs using the virus-speicific data and bacteria-speicific data, then using more general databases nt and nr. The results are as attached. For some samp

Processing Spatial Transcriptomics Data Using Space Ranger

Author: gene_x

Abstract: Using spaceranger to process spatial transcriptomics data involves several steps, from preparing the necessary input files to running the analysis and interpreting the results. Below, I'll provide a c

How to Create a New User on Ubuntu Server?

Author: gene_x

Abstract: 1. Restricting User 'malawi' from Installing System-wide Programs and Verifying Permissions chmod o-rx /home/jhuang ls -ld /home/jhuang cd /home/jhuang groups malawi


© 2023 XGenes.com Impressum